|
OriGene
control scrambled shrna ![]() Control Scrambled Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pm22250198-272-10-16?v=OriGene Average 95 stars, based on 1 article reviews
control scrambled shrna - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
OriGene
pgfp v rs ca v 1 2 shrna ![]() Pgfp V Rs Ca V 1 2 Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/bio_rxiv__64898__2025__12__11__693636-221-0-9?v=OriGene Average 95 stars, based on 1 article reviews
pgfp v rs ca v 1 2 shrna - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
OriGene
shrna ![]() Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/10__1161_slash_jaha__117__007457-36-6-24?v=OriGene Average 96 stars, based on 1 article reviews
shrna - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting shrna expression vector ![]() Non Targeting Shrna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pmc05136313-67-1-8?v=Addgene+inc Average 96 stars, based on 1 article reviews
non targeting shrna expression vector - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
OriGene
scramble sirna ![]() Scramble Sirna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pm27302678-66-7-14?v=OriGene Average 93 stars, based on 1 article reviews
scramble sirna - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
OriGene
scr shrna pgfp b rs ![]() Scr Shrna Pgfp B Rs, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/10__1158_slash_0008___5472__can___16___1666-32-23-24?v=OriGene Average 91 stars, based on 1 article reviews
scr shrna pgfp b rs - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Addgene inc
scrambleshrna plasmid ![]() Scrambleshrna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pm41435878-81-1-3?v=Addgene+inc Average 93 stars, based on 1 article reviews
scrambleshrna plasmid - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Xeragon Inc
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) ![]() Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pmc01894765-362-7-9?v=Xeragon+Inc Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
sirna for sp1 or ctcf and scramble sirna ![]() Sirna For Sp1 Or Ctcf And Scramble Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/10__1161_slash_atvbaha__114__303899-151-7-14?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
sirna for sp1 or ctcf and scramble sirna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Ribobio co
scrambled negative control sirna ![]() Scrambled Negative Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pm40643013-111-9-14?v=Ribobio+co Average 90 stars, based on 1 article reviews
scrambled negative control sirna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna of arg2, ho-1, creb1 and their matched scramble control ![]() Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pm37856999-80-4-14?v=Ribobio+co Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Ribobio co
scrambled or zap sirnas ![]() Scrambled Or Zap Sirnas, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sirna+against+sr%E2%80%90bi+or+noncoding+%28scrambled%29+sirna/pmc04210284-297-8-10?v=Ribobio+co Average 90 stars, based on 1 article reviews
scrambled or zap sirnas - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of cell science
Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.
doi: 10.1242/jcs.091736
Figure Lengend Snippet: Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or P2Y13 shRNAs. Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and
Techniques: shRNA, Staining, Fluorescence, Transfection, Expressing, In Vitro, Incubation, Control
Journal: Journal of cell science
Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.
doi: 10.1242/jcs.091736
Figure Lengend Snippet: Fig. 5. Adenylate cyclase activity is necessary for ADP–P2Y1-dependent axon elongation. (A) Hippocampal neurons treated with the indicated compounds from day 1 to day 3 in vitro and stained for MAP2 and Tau-1. Scale bar: 100 mm. (B) Axon length in neurons treated with vehicle (black bars) or the indicated adenylate cyclase or cAMP regulators (white bars), in combination with agonists or antagonists of P2Y1 or P2Y13. Graphs represent the mean axon length ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001, **P,0.01; n.s., not significant. (C,E) Hippocampal neurons nucleofected with P2Y1 shRNA and stained at 3 DIV for Tau-1 or a-tubulin (red). Nucleofected neurons were identified by GFP fluorescence. Neurons were treated with the adenylate cyclase activator forskolin (5 mM) or a PDE4 inhibitor (20 nM). Note that both treatments reversed the negative effects of P2Y1 silencing or P2Y13 expression on axon elongation. The graphs in E show the axonal lengths ± s.e.m. from three independent experiments, analyzing 100 GFP positive neurons for each condition in each experiment; ***P,0.001. (D,F) Neurons nucleofected with P2X7 shRNA or P2X7– GFP expression plasmids and treated from day 1 to day 3 in vitro with the adenylate cyclase inhibitor (SQ-22536) or the adenylate cyclase activator forskolin, respectively. Note that adenylate cyclase activation or increased cAMP levels reversed the negative effect of P2X7–GFP expression on axon elongation. The graphs in F show the axon length ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm.
Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and
Techniques: Activity Assay, In Vitro, Staining, shRNA, Fluorescence, Expressing, Activation Assay
Journal: Journal of cell science
Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.
doi: 10.1242/jcs.091736
Figure Lengend Snippet: Fig. 6. Adenylate cyclase 5 activity is required for proper axonal elongation in response to ADP or P2X7 inhibition. (A,D) Hippocampal neurons cultured from day 1 to day 3 in vitro in the presence or absence of the PKCf inhibitor, PKCf pseudosubstrate (10 mM) in combination with ADP 5 mM, BBG 100 nM, MRS-2211 5 mM or forskolin 5 mM. Neurons were stained with anti-MAP2 and anti-Tau-1 antibodies. Graph in D shows the mean axonal lengths ± s.e.m. from three independent experiments. (B) Distribution of adenylate cyclase 5 in hippocampal neurons at 3 DIV. Arrow indicates the AC5 in the distal region of the axon. Right panels show the distal region of the axon stained for AC5 and F-actin. Scale bar: 100 mm. (C) Hippocampal neurons treated from day 1 to day 3 in vitro with ADP (5 mM) in the presence or absence of the adenylate cyclase 5 inhibitor NY80 (10 mM). Scale bar: 100 mm. (E) Mean axon lengths ± s.e.m. of 3 DIV neurons treated with vehicle (black bars) or NKY80 (white bars), in combination with ADP (5 mM), the P2Y13 antagonist MRS-2211, dbcAMP (2 mM), rPMT or PTX. Note that addition of dbcAMP impaired the inhibitory effect of NKY80 on axon growth; ***P,0.001. Data are from three independent experiments analyzing 100 neurons for each condition in each experiment. (F,H) Neurons nucleofected with GFP, P2Y1–GFP, scrambled shRNA, P2X7 shRNA or P2Y13 shRNA were cultured from day 1 to day 3 in vitro with vehicle or the adenylate cyclase 5 inhibitor, NKY80. (F) Representative images of these neurons. (H) Mean axonal lengths ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. (G,I) Neurons were nucleofected with scrambled shRNA or AC5 shRNA. (G) Representative images of 3 DIV neurons. (I) Mean axon length ± s.e.m. of neurons shown in G cultured in the presence of the indicated compounds at the concentrations shown previously. Scale bars: 100 mm.
Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and
Techniques: Activity Assay, Inhibition, Cell Culture, In Vitro, Staining, shRNA
Journal: Molecular cancer therapeutics
Article Title: Mutant BRAF upregulates MCL-1 to confer apoptosis resistance that is reversed by MCL-1 antagonism and cobimetinib in colorectal cancer
doi: 10.1158/1535-7163.MCT-16-0017
Figure Lengend Snippet: A, ERK knockdown by siRNA was performed in VACO432 (BRAFV600E/WT), as well as isogenic VACO432 VT1 (BRAFWT/−) cells with ectopic BRAFV600E vs empty vector (EV). Protein expression was determined by immunoblotting. B, Ectopic expression of HA-tagged wild type (WT) MCL-1, and phosphorylation-mimicking [T92D/T163D (DD)] or unphosphorylated [T92A/T163A (AA)] MCL-1 mutants was performed in HT29 cells. C, Cell lines were treated with cycloheximide (5 mmol/L) for the indicated times and protein expression against HA-tagged MCL-1 was analyzed by immunoblotting. The level of MCL-1 expression was then quantified by densitometry and normalized using tubulin expression.
Article Snippet: The
Techniques: Knockdown, Plasmid Preparation, Expressing, Western Blot, Phospho-proteomics
Journal: Molecular cancer therapeutics
Article Title: Mutant BRAF upregulates MCL-1 to confer apoptosis resistance that is reversed by MCL-1 antagonism and cobimetinib in colorectal cancer
doi: 10.1158/1535-7163.MCT-16-0017
Figure Lengend Snippet: A, RKO and HT29 cells were transduced with lentiviral MCL-1 (#50 or #443) vs control shRNA (#293). Cells with stable expression were then incubated with cobimetinib for 48h at the indicated doses. Apoptosis was analyzed by annexin V+ staining that was quantified using flow cytometry. Mean values were derived from triplicate experiments and bars represent S.D. *p<0.05. B, Apoptosis was also analyzed by expression of cleavage (CL) of PARP and CASPASE-3 by immunoblotting in both cell lines. C, HT29 cells containing stable expression of control (#293) or MCL-1 (#50) shRNA were grown as tumor xenografts in SCID mice. Xenograft-bearing mice with dosed with either vehicle or cobimetinib (15 mg/kg every 3 days by oral gavage) for 14 consecutive days. Xenograft mean tumor volumes are plotted against days of treatment for vehicle- and cobimetinib-treated mice. Error bars represent SEM. Statistical significance(*, P < 0.05) is shown for comparison of MCL-1 (#50) shRNA + cobimetinib vs control (#293) shRNA + cobimetinib. D, Pre-treatment expression of MCL-1 in tumors from xenograft-bearing mice was evaluated by immunoblotting (upper panel). Post-treatment expression of pERK/ERK, MCL-1, cleaved PARP and cleaved caspase-3 in tumor xenografts from the 4 groups of tumor-bearing mice were evaluated by immunoblotting (lower panel).
Article Snippet: The
Techniques: Transduction, Control, shRNA, Expressing, Incubation, Staining, Flow Cytometry, Derivative Assay, Western Blot, Comparison
Journal: Molecular cancer therapeutics
Article Title: Mutant BRAF upregulates MCL-1 to confer apoptosis resistance that is reversed by MCL-1 antagonism and cobimetinib in colorectal cancer
doi: 10.1158/1535-7163.MCT-16-0017
Figure Lengend Snippet: A, RKO and HT29 cell lines were treated with A-1210477, cobimetinib, or in combination for 16 h. Immunoprecipitation (IP) was performed in whole cell lysates (WCL) using conformation-specific antibodies against BAK or BAX (6A7). Normal rabbit (for BAK) and mouse (for BAX) IgG served as antibody controls. B, Cells were treated with A-1210477, cobimetinib, or their combination for 3 h and IP was then performed in WCL using an anti-MCL-1 antibody. Co-precipitated protein complexes were probed for BIM, BAK or BAX by immunoblotting. Normal rabbit IgG served as an antibody control. C, RKO and HT29 cell lines with stable expression of control (#293) or BIM (#49) shRNA were incubated with A-1210477, cobimetinib. or their combination for 16 h. IP was then performed in WCLs using conformation-specific antibodies against BAK or BAX in these cell lines. The effect of BIM shRNA on BIM protein expression was confirmed by immunoblotting.
Article Snippet: The
Techniques: Immunoprecipitation, Western Blot, Control, Expressing, shRNA, Incubation
Journal: Experimental neurology
Article Title: Role of PDGF-D and PDGFR-β in neuroinflammation in experimental ICH mice model.
doi: 10.1016/j.expneurol.2016.06.010
Figure Lengend Snippet: Fig. 5. Effects of plasmin on PDGF-D induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D siRNA attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Article Snippet: Experiment 5: The PDGF-D siRNAs mixture or
Techniques: Activation Assay, Injection, Recombinant